September 11, 2026

From the pelleted cells, periplasmic proteins were extracted by osmotic shock [36]

From the pelleted cells, periplasmic proteins were extracted by osmotic shock [36]. fly. Furthermore, Nbs can easily be mutagenized and selected for increased proteolytic stability [33]. Finally, the capacity of the secreted Nb_An33 to recognize its epitope on living trypanosomes was confirmed by flow cytometry and fluorescence microscopy using alkaline binding conditions that are relevant for the tsetse fly midgut physiology. Growth curve analysis and cell population doubling time of the em S. glossinidius /em strains harboring the different expression constructs showed that there was a strong correlation between the ability of the em S. glossinidius /em strains to export the Nb_An33 fusion protein and growth performance. Strains expressing Nb_An33 intracellularly showed a significant reduction in growth rate compared to the WT strains, while secreting strains were not affected in their growth. These results suggest that accumulation of Nb_An33 in the cytoplasm imparts a detrimental effect on growth performance and that efficiently secreting Nb_An33 to the periplasm rescues this effect, allowing the strain to grow with kinetics similar to the WT strain. Conclusions This study provides the first demonstration of the functional expression and extracellular delivery of trypanosome-interfering proteins in em S. glossinidius /em . ZK-261991 Moreover, we demonstrated that em S. glossinidius /em expressing pelBNb_An33 exhibited no significant reduction in terms of fitness, determined by em in vitro /em growth kinetics, compared to the wild-type strain. This ability of the recombinant em S. glossinidius /em strain to effectively compete with native strains is of great importance to the overall success of the paratransgenesis strategy. Given the ability of em S. glossinidius /em to express high levels of active Nb_An33 and the capacity to release this anti-trypanosome Nb without hampering the bacterium viability, the foundation has been laid for further exploration of the inhibitory effect on trypanosome development in the tsetse fly. For this, highly potent trypanolytic Nbs have been developed very recently that lyse trypanosomes both em in vitro /em and em in vivo /em by interfering with the parasite endocytic pathway [34]. The current study also reinforces the notion for the potential of em S. glossinidius /em to be developed into a paratransgenic platform organism. At a broad level, the concept of using Nbs as effector molecules to be delivered by bacterial endosymbionts is not limited to the tsetse fly-trypanosome model but could also be applied in a paratransgenic approach to encompass other vector-borne diseases. Methods Insects, bacterial strains and culture conditions Rabbit polyclonal to Caspase 3.This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family.Sequential activation of caspases em Sodalis glossinidius /em strains used in this study were isolated from the hemolymph of surface-sterilized em Glossina morsitans morsitans /em from the colony maintained at the Institute of Tropical Medicine (Antwerp, Belgium). Cultures were maintained em in vitro /em at 26C in liquid Mitsuhashi-Maramorosch (MM) insect medium (PromoCell) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS). For cloning, em S. glossinidius /em strains were cultivated on MM agar plates composed of MM medium (without FBS) solidified by autoclaving after the addition of 1% of bacto-agar. Blood agar plates were supplemented with 10% packed horse blood cells (IMP) and yeastolate (5 mg/ml) (Gibco). All solid cultures were cultivated in micro-aerophilic conditions generated using the Campygen pack system (Oxoid) which provided 5% O2, 10% CO2, balanced with N2 at 26C. Where appropriate, antibiotics were added to the media at the following concentrations: 100 g/ml of ampicillin and 50 g/ml of kanamycin. Plasmids constructs Plasmids used in this study and the structure of the fused genes are shown in Figure ZK-261991 ?Figure1.1. em Nb_An33 /em , coupled to the em pelB /em leader sequence and followed by a 6xHis tag was amplified as a em XbaI /em – em EcoRI /em fragment by PCR from the pHen6C plasmid containing the em pelBNb33 /em gene using the following primer set: pelBNb33_FW, 5′-TTTTTCTAGAATGAAATACCTATTGCCTACGG-3′ and Nb33_Rev, 5′- TTTTGAATTCTTAGTGATGGTGATGGTGGTGTGAGGAGACGGTGACCTG-3′ ( em XbaI /em – em EcoRI /em restriction sites are underlined). The resulting 438 bp PCR product was cloned into pCM66 [35] to create ZK-261991 ppelBNb33 em lac /em . Nb33_FW, 5′-ATATTCTAGATGATGTGCAGCTGGTGGAGTC-3′ was used to create pNb33 em lac /em without any secretion signal. To create pFliCNb33 em fliC /em and pFliCpelBNb33 em fliC /em , a 510 bp fragment including the em FliC /em promoter region ( em PfliC /em ) and a 210 bp fragment em FliC /em , encoding 70 N-terminal amino acids of the em S. glossinidius FliC /em gene, was inserted in-frame between the em SphI /em – em XbaI /em restriction sites of pNb33 em lac and /em ppelBNb33 respectively, with the following primer set: FliC_FW, 5′- GCATGCCATGTCCCAGGTCATT-3′ and FliC_Rev, 5′-ATATCTAGAGTCATTGGCGCATG-3′( em SphI /em – em XbaI /em restriction sites are underlined). All plasmids were sequenced to confirm the desired DNA sequence and the correct reading frame. Genetic transformation of Sodalis glossinidius Plasmid constructs.