July 18, 2026

4A-B and data not shown)

4A-B and data not shown). effect and Fc-mediated depletion. These data implicate tumor CTLA-4 in cancer cell-mediated immunosuppression and to have a functional role on tumor cells is usually capable of reducing leukemic burden. Materials and Methods Primary Human Samples and Cell Lines Patient blood was obtained in ACD tubes at The Ohio State University with consent and in Sincalide accordance with the Declaration of Helsinki. B and T-cells were negatively selected using RosetteSep (StemCell Technologies) and ficoll. The Mec1 cell line was obtained from DSMZ and the OSU-CLL cell line from The Ohio State University(22, 23). Except for where directly indicated that cells had been frozen, all cells used were freshly isolated. Normal donor cells were collected using the same methods as patient cells from fresh Cd248 blood (volunteers or Redcross). Sincalide Mec1 and OSU-CLL were maintained in RPMI 1640 (10% FBS+56U/mL penicillin+56g/mL streptomycin+2mM L-glutamine). Hek293 (ATCC) and Phoenix Ampho (Orbigen) cells were maintained in DMEM (10% FBS+56U/mL penicillin+56g/mL streptomycin +2mM L-glutamine). Real time qPCR RNA was isolated using Trizol (Invitrogen), alcohol precipitation, and column purification (Qiagen). cDNA was prepared using random hexamers and MMLV reverse transcriptase (Invitrogen). Taqman assays were used for RT-qPCR (Applied Biosystems). Plasmids The pRetro-tight-pur system was used to produce dox-inducible CTLA-4 or empty vector B-cell lines (Clonetech). Full length CTLA-4 cDNA (sequence “type”:”entrez-nucleotide”,”attrs”:”text”:”NM_005214.3″,”term_id”:”83700229″,”term_text”:”NM_005214.3″NM_005214.3) was obtained from Origene, restriction digested with NotI, and ligated into pRetro. The CTLA-4pRetro or empty vector retro viral plasmids were packaged by Phoenix cells, supernatant collected and 0.45m filtered. Tet+ Mec1 and OSU-CLL cell lines were infected with CTLA-4pRetro or empty vector virus and selected using 1g/mL puromycin+500g/mL G418. CD80-GFP and CD86-GFP plasmids were obtained from Origene and stably transfected into Hek293 cells using calcium phosphate (Promega) and selected with 500g/mL G418. Full length CTLA-4, CD80, and CD86 sequence inserts were all validated by Sanger Sequencing at the OSU Nucleic Acid Shared Resource Core facility. Primers for sequencing: VP1.5 F: 5 GGACTTTCCAAAATGTCG 3, XL39 R: 5 ATTAGGACAAGGCTGGTGGG 3, RetroF: 5 ATTAGGACAAGGCTGGTGGG 3, 5ATCTGAGGCCCTTTCGTCTTCACTC 3, RetroR: 5 TGTGTGCGAGGCCAGAGGCCACTT 3, Nested CTLA-4 Sincalide F: 5 GACCTGAACACCGCTCCCATAAAGC 3, Nested CD86GFP F: 5 GCCTCCCCCAGACCACAT 3, Nested CD86GFP R: 5 GGTGCTCTTCATCTT GTTGGTCAT 3 Antibodies and Reagents Anti-human antibodies CTLA-4 (Clone BNI3; PE, APC, or BV421), CD80 (Clone L307.4, FITC, PE, V450), CD86 (Clone 2331/FUN-1 PE, PerCP-Cy5.5), CD69 (Clone FN50-V450, TP1.55.3-PE), CD19 (Clone HIB19 FITC, AF647), CD5 (Clone UCHT2 APC), CD3 (Clone UCHT1; ECD, AF700), and Isotype controls (PE, APC) Sincalide were obtained from BD Biosciences, Biolegend, and Beckman Coulter. Violet and Near IR live/dead stains (Life technologies) and claret membrane dye (Sigma) were used for flow cytometry. Anti-murine CTLA-4 (Clone UC10-4F10-11, PE), CD19 (Clone 1D3 AF647), and CD5 (Clone 53-7.3 FITC, BV421) and human or murine Fc block were purchased from BD Biosciences. Cells were surface stained in flow buffer (5%FBS, 0.1% NaN3) and fixed and permeabilized for intracellular staining using BD Cytofix/cytoperm. Intracellular stains were in BD perm/wash buffer. T-cells were stimulated with 10 g/mL plate bound anti-CD3 (ebioscience) +/? 1 g/mL soluble anti-CD28 (eBioscience) or 1:1 Beads:T-cells anti-CD3/CD28 dynabeads (Gibco). Ipilimumab was obtained from the OSU Pharmacy. Flow Cytometry Cells were analyzed on an FC500 (Beckman Coulter), Gallios (Beckman Coulter), or LSR Fortessa (BD). Adherent cells were removed from the plate using Accutase (Gibco). Dynabeads were removed using a dynabead magnet and washed 1x with PBS. Briefly, cells were surfaced stained for 15-20min at room temp or on ice, respectively, in either PBS or flow buffer (5%FBS+0.1%NaN3) depending on the stains used. Where applicable, surface staining was followed by 20min fixation and permeabilization (BD Cytofix/cytoperm) on ice and 30min intracellular staining in BD perm/wash buffer. Mouse peripheral blood analysis was performed by whole blood staining for 15min at 4?C, red blood cells lysed (eBioscience), no wash, and countbrite beads (Life Technologies) added prior to obtaining absolute lymphocyte counts. B-T co-culture Cells were plated at a 1:1 ratio of B:T-cells (except in autologous experiments 1:1- 2.5:1 B:T) and at 3-5e6 cells/mL. Surface CTLA-4 expression was determined by flow cytometry at 48h. For Mec1/ T-cell co-cultures, Mec1 cells were treated +/? doxycycline and +/? 10 g/mL Ipilimumab for 24h and washed 2x prior.